megashortscript t7 rna polymerase kit (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
megashortscript t7 rna polymerase kit
Megashortscript T7 Rna Polymerase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+rna+polymerase+megashortscript+kit/pmc01142345-81-17-22
Average 90 stars, based on 1 article reviews
Megashortscript T7 Rna Polymerase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t7+rna+polymerase+megashortscript+kit/pmc01142345-81-17-22
Average 90 stars, based on 1 article reviews
megashortscript t7 rna polymerase kit - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Generated:Article Title: Altered Strand Transfer Activity of a Multi-drug-resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutant with a Dipeptide Fingers Domain Insertion Article Snippet: T7 RNA polymerase Megashortscript kit (Ambion) was implemented for synthesis of Donor 80 nucleotide (nt) RNA using the purified PCR product as a template and the primer PCIS 14 (TGGTAAACATTCTTGAGTGC). .. The 119 nt acceptor RNA template were generated from Plasmid Preparation:Article Title: Altered Strand Transfer Activity of a Multi-drug-resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutant with a Dipeptide Fingers Domain Insertion Article Snippet: T7 RNA polymerase Megashortscript kit (Ambion) was implemented for synthesis of Donor 80 nucleotide (nt) RNA using the purified PCR product as a template and the primer PCIS 14 (TGGTAAACATTCTTGAGTGC). .. The 119 nt acceptor RNA template were generated from Article Title: The newly discovered Q motif of DEAD-box RNA helicases regulates RNA-binding and helicase activity Article Snippet: .. A 44-nucleotide-long RNA was transcribed off the Hin d-III-cut plasmid using the Purification:Article Title: Structural analysis reveals the characteristic features of Mtr4, a DExH helicase involved in nuclear RNA processing and surveillance Article Snippet: The coding sequence for S. cerevisiae tRNA iMet preceded by a T7 promoter sequence was cloned in a pUC19 vector by assembly of overlapping phosphorylated oligonucleotides. .. RNA was transcribed using the Article Title: Altered Strand Transfer Activity of a Multi-drug-resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutant with a Dipeptide Fingers Domain Insertion Article Snippet: The PCR product was then purified by agarose gel electrophoresis and Qiaquick gel extraction kit (Qiagen). .. Polymerase Chain Reaction:Article Title: Altered Strand Transfer Activity of a Multi-drug-resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutant with a Dipeptide Fingers Domain Insertion Article Snippet: The PCR product was then purified by agarose gel electrophoresis and Qiaquick gel extraction kit (Qiagen). .. |